авторефераты диссертаций БЕСПЛАТНАЯ РОССИЙСКАЯ БИБЛИОТЕКА - WWW.DISLIB.RU

АВТОРЕФЕРАТЫ, ДИССЕРТАЦИИ, МОНОГРАФИИ, НАУЧНЫЕ СТАТЬИ, КНИГИ

 
<< ГЛАВНАЯ
АГРОИНЖЕНЕРИЯ
АСТРОНОМИЯ
БЕЗОПАСНОСТЬ
БИОЛОГИЯ
ЗЕМЛЯ
ИНФОРМАТИКА
ИСКУССТВОВЕДЕНИЕ
ИСТОРИЯ
КУЛЬТУРОЛОГИЯ
МАШИНОСТРОЕНИЕ
МЕДИЦИНА
МЕТАЛЛУРГИЯ
МЕХАНИКА
ПЕДАГОГИКА
ПОЛИТИКА
ПРИБОРОСТРОЕНИЕ
ПРОДОВОЛЬСТВИЕ
ПСИХОЛОГИЯ
РАДИОТЕХНИКА
СЕЛЬСКОЕ ХОЗЯЙСТВО
СОЦИОЛОГИЯ
СТРОИТЕЛЬСТВО
ТЕХНИЧЕСКИЕ НАУКИ
ТРАНСПОРТ
ФАРМАЦЕВТИКА
ФИЗИКА
ФИЗИОЛОГИЯ
ФИЛОЛОГИЯ
ФИЛОСОФИЯ
ХИМИЯ
ЭКОНОМИКА
ЭЛЕКТРОТЕХНИКА
ЭНЕРГЕТИКА
ЮРИСПРУДЕНЦИЯ
ЯЗЫКОЗНАНИЕ
РАЗНОЕ
КОНТАКТЫ

Pages:   || 2 | 3 | 4 |

Продуктивные качества свиней пород дюрок и скороспелая мясная степного типа разных генотипов по локусам esr и h-fabp

-- [ Страница 1 ] --

На правах рукописи

КАГРАМАНОВ АРАМ РОМАЕВИЧ

Продуктивные качества свиней пород дюрок и скороспелая мясная степного типа разных генотипов по локусам ESR и H-FABP

06.02.07 – разведение, селекция и генетика

сельскохозяйственных животных

АВТОРЕФЕРАТ

диссертации на соискание ученой степени

кандидата биологических наук

Ставрополь 2011

Работа выполнена в ГНУ Ставропольский научно-исследовательский институт животноводства и кормопроизводства Россельхозакадемии

Научный руководитель: доктор сельскохозяйственных наук, профессор Семенов Владимир Владимирович

Официальные оппоненты: доктор ветеринарных наук, профессор

Грига Эдуард Николаевич

доктор биологических наук

Селионова Марина Ивановна

Ведущая организация: Государственное научное учреждение

Всероссийский

научно-исследовательский институт

генетики и разведения

сельскохозяйственных животных

Россельхозакадемии (ГНУ ВНИИГиРЖ РАСХН)

Защита диссертации состоится « 20 » мая 2011 г. в «1130» ч. на заседании диссертационного совета Д 006.078.01 при Ставропольском научно-исследовательском институте животноводства и кормопроизводства по адресу: 355017, Россия, Ставропольский край, г. Ставрополь, пер. Зоотехнический, 15, тел./факс (8652) 71-70-33.

С диссертацией можно ознакомиться в библиотеке ГНУ СНИИЖК Россельхозакадемии

Автореферат разослан и размещен на официальном сайте института - http:www.sniizhk.ru « 19 » апреля 2011 г.

Ученый секретарь

диссертационного совета Кононова Л.В.

1. Общая характеристика работы

1.1 Актуальность темы. Современное свиноводство активно осваивает интенсивные технологии, динамично развивается, что обеспечивает устойчивое увеличение производства продукции. Однако на практике биологический и генетический потенциал животных реализуется ещё не в полной мере.

Создание специализированных линий свиней, имеющих лучшие в популяции продуктивные и потребительские качества невозможно без применения современных методов генетики. Работа по изучению генов, их маркирование и взаимосвязи с хозяйственно-полезными признаками позволяет улучшать популяции, породы, вести целенаправленное наследование признаков и совершенствовать селекционный процесс, опираясь на генодиагностику. Более детальное изучение и внедрение генетики к традиционным методам отбора животных, позволит ускорить селекционный процесс в свиноводстве.

1.2. Цель и задачи исследований. Цель работы – установление влияния аллельных вариантов генов эстрогенового рецептора (ESR) и гена белка связывающего жирные кислоты (H-FABP) с воспроизводительными и мясными качествами свиней пород дюрок и скороспелая мясная степного типа (СМ-1 СТ).

В задачи исследований входило:

1. Изучить полиморфизм генов ESR и H-FABP у свиней пород дюрок и скороспелая мясная степного типа разных половозрастных групп.

2. Изучить влияние аллельных вариантов гена эстрогенового рецептора на воспроизводительные качества свиней пород дюрок и скороспелая мясная степного типа.



3. Изучить влияние аллельных вариантов гена белка, связывающего жирные кислоты на откормочные и мясные качества свиней пород дюрок и скороспелая мясная степного типа.

4. Рассчитать экономическую эффективность внедрения ДНК-диагностики генов ESR и H-FABP при разведении и селекции свиней.

1.3. Научная новизна. Получены новые данные, отображающие особенности частот встречаемости маркерных аллелей генов ESR и H-FABP у свиней породы дюрок и СМ-1 СТ, разводимых в Ставропольском крае. Оценен полиморфизм генов ESR и H-FABP свиней и влияние аллельных вариантов генов на воспроизводительные, откормочные и мясные качества свиней пород дюрок и скороспелая мясная степного типа.

1.4. Практическая значимость. Проведенные исследования позволяют определить продуктивные возможности свиней различных генотипов по локусам генов ESR и H-FABP. Установлена роль ДНК-диагностики по маркерам связанным с хозяйственно-полезными признаками свиней, что позволяет целенаправленно вести отбор для последующих генераций.

Данные о аллельных вариантах генов и результатах оценки их влияния на хозяйственно-полезные признаки используются в хозяйствах Ставропольского края при разработке селекционно-генетических программ совершенствования стад, направленных на увеличение продуктивности свиней.

Результаты диссертационных исследований внедрены в ОАО “Совхоз им. Кирова” Труновского района, СПК “Родина” Красногвардейского района Ставропольского края.

1.5. Основные положения диссертационной работы, выносимые на защиту:

- особенности формирования воспроизводительных качеств свиней с учетом полиморфизма гена эстрогенового рецептора;

- особенности формирования мясной продуктивности с учетом полиморфизма гена белка связывающего жирные кислоты;

- влияние аллельных вариантов генов ESR и H-FABP на воспроизводительную и мясную продуктивность свиней пород дюрок и СМ-1 СТ.

1.6. Апробация работы. Основные положения диссертации доложены на ежегодных отчетах лаборатории свиноводства, на заседаниях Ученого совета ГНУ СНИИЖК в 2008 – 2010 гг. (г. Ставрополь); Всероссийской научно-практической конференции «Актуальные проблемы производства свинины в РФ» (п. Нижний Архыз, 2008); Международной научно-практической конференции «Современные достижения биотехнологии воспроизводства – основа повышения продуктивности сельскохозяйственных животных» (г. Ставрополь, 2009); XVII международной научно-практической конференции по свиноводству «Современные проблемы интенсификации производства свинины в странах СНГ» (г. Ульяновск, 2010).

1.7. Публикация результатов исследований. По материалам диссертации опубликовано 9 научных работ, в т.ч. 3 - в издании, рекомендованном ВАК РФ.

1.8. Объем и структура диссертации. Диссертация изложена на 107 страницах компьютерного текста, содержит 20 таблиц, 9 рисунков, включает введение, обзор литературы, материал и методы исследования, результаты собственных исследований, обсуждения, выводы, предложения производству, список литературы (насчитывающий 156 источников, в т. ч. 34 зарубежных), приложение.

2. Материал и методы исследований

Исследования проводились в ОАО “Совхоз им. Кирова” Труновского района Ставропольского края в период с 2007 по 2010 гг. Объектом исследования являлись свиньи пород: дюрок и скороспелая мясная степного типа. Схема исследований приведена на рисунке 1.

Рис 1. Общая схема исследований

Животные опытных групп находились в одинаковых условиях кормления и содержания.

Полиморфизм генов эстрогенового рецептора (ESR) и белка связывающего жирные кислоты (H-FABP) определяли с помощью полимеразной цепной реакции (ПЦР) по методике Л.А. Калашниковой (1997), Н.А. Зиновьевой (1999), используя соответствующие праймеры.

Выделение ДНК из проб крови проводили с помощью реагентов DIAtomTM DNA Prep 100 (ООО «Лаборатория Изоген», г.Москва). Амплификация проводилась набором реагентов для PCR амплификации ДНК – GenеPak PCR Core.

Для амплификации участка генов использовалась следующая последовательность праймеров:

- для участка гена эстрогенового рецептора:

5 GACTGTTCCCTTCTGAGACTTAATG 3

5 CTCTTGGGAAAATGTCCTGAATTTAG 3

- для амплификации гена H-FABP:

Аллель D: FABP3: ATT CAG CTA CTC AGC TGT TTC C 3'

FABP4: AAC AAA CTC TCA GGA ATG GGA G 3'.

Аллель Н: FABP1: 5'AAG AGG ACC AAG ATG CCT ACG 3'

FABP2: 5' TGC TGT CCA CTA GCT TCC AGG 3'.

Полученные пробы разрезаны и разделены в агарозном геле с помощью эндонуклеазы Pvu II (ESR), Hinf I (H-FABP, по типу Н), Hae III (H-FABP, по типу D).

Для оценки мясной продуктивности свиней был проведен контрольный убой при достижении животными 100 кг живой массы по методике ВИЖа (1974).

Экономическую эффективность результатов научно- производственного эксперимента определяли по «Методике определения экономической эффективности использования в сельском хозяйстве результатов научно – исследовательских испытаний опытно – конструкторских работ, новой технике, изобретений и рационализаторских предложений» (Г.М. Лоза, 1994).

Полученные цифровые данные обрабатывались методами описательной статистики. Определение достоверности разницы между исследуемыми значениями проводились посредством применения критерия однофакторного дисперсионного анализа при Р <0,05*; Р <0,01**; Р <0,001*** (Г.Ф. Лакин, 1990; В.М. Зайцев и др., 2003; Д.А. Новиков, 2005), а также на ПК с использованием пакета программ «Microsoft Office 2003».

3. Результаты исследований

3.1 Полиморфизм гена эстрогенового рецептора и его влияние на воспроизводительные качества свиней разных пород

Необходимость углубленного изучения генетических факторов, влияющих на многоплодие, обусловлена тем, что этот признак, в значительной мере, определяет продуктивность свиней и имеет низкий коэффициент наследуемости, в этой связи поиск и использование генетически предрасположенных животных к многоплодию, имеет большое практическое значение в селекции. Основным моментом наших исследований явилось изучение полиморфизма гена ESR у свиней пород дюрок и скороспелой мясной степного типа.

Частота встречаемости аллеля А в воспроизводящей части стада (хряки, свиноматки) составила от 0,675 до 1,0, в тоже время предпочтительный для селекции аллельный вариант В у представленных животных был низок и составил – 0,2 – 0,3 соответственно (табл. 1).

Таблица 1 - Частота встречаемости генотипов гена ESR в разных половозрастных группах пород дюрок и СМ-1 СТ

Порода Половозрастные группы n Частота аллелей Частота генотипов, %
А В АА АВ ВВ
дюрок свиноматки 20 0,675 0,325 55,0 25,0 20,0
хряки 5 1,0 - 100,0 - -
поросята 50 0,64 0,36 64,0 36,0 -
СМ-1 СТ свиноматки 20 0,65 0,35 45,0 40,0 15,0
хряки 5 0,80 0,20 60,0 40,0 -
поросята 50 0,69 0,31 44,0 50,0 6,0

Полиморфизм по гену ESR у свиноматок породы дюрок и скороспелой мясной степного типа, представлен гомозиготным АА и гетерозиготным АВ генотипами. При этом частота встречаемости у указанных пород составила – 55,0 и 25,0%, 45,0 и 40,0% соответственно. В 20,0% случаев выявлено присутствие гомозиготного ВВ генотипа у свиноматок породы дюрок и 15% - у СМ-1 СТ. Однако у хряков породы дюрок полиморфизм данного гена не выявлен и представлен гомозиготным АА генотипом (100%). У хряков породы СМ-1 СТ частота встречаемости генотипов составила АА – 60%, АВ – 40%. Предпочтительный для селекции генотип ВВ у хряков данных пород не выявлен.

Генотипирование молодняка позволило выявить высокую частоту встречаемости генотипа АА (64%), низкую – АВ (36%) и отсутствие – ВВ генотипов среди поросят породы дюрок. Среди поросят породы СМ-1 СТ установлены незначительные отличия по генотипам АА и АВ, что составило 44 и 50% соответственно, гетерозиготный ВВ генотип выявлен у 6% поросят. Однако, при высокой частоте встречаемости аллеля А (0,64), в генном наборе потомства породы дюрок частота встречаемости аллеля В составила всего лишь 0,36. В то же время, у потомков породы скороспелая мясная степного типа частота встречаемости желательного для селекции аллеля В эстрогенового рецептора составила 0,31.

В сравнительном аспекте частота встречаемости генотипов гена ESR у свиней изученных пород представлена в табл. 2.

Таблица 2 - Частота встречаемости генотипов гена эстрогенового рецептора свиней пород дюрок и СМ-1 СТ

Порода n Частота аллелей Частота генотипов 2
А В АА АВ ВВ
n % n % n %
Дюрок 75 0,79 0,21 48 64,0 23 30,7 4 5,3 0,315
СМ-1 СТ 75 0,69 0,31 34 45,3 35 46,7 6 5,3 0,702




Основная масса животных (n = 48) породы дюрок несет гомозиготный генотип АА - 64,0%, доля гетерозиготных АВ - 30,7%, а гомозиготных ВВ - 5,3%. По частоте встречаемости генотипов у свиней породы скороспелая мясная степного типа распределились следующим образом: АА генотип несли 45,3% (n = 34), АВ – 46,7% (n = 35), ВВ – 5,3% (n = 6) животных.

Наибольшая разница между числом фактического и теоретического распределения генотипов (больший недостаток гетерозигот) отмечена по гетерозиготному варианту АВ у породы дюрок - 23,0 против 24,8, в то время как в популяции свиней СМ-1 СТ этот показатель составил 35,0 против 32,6. Показатель вариабельности хи-квадрат у свиней породы дюрок составил - 0,315, у скороспелой мясной степного типа – 0,702 и не превышал его табличного значения. В результате полученных данных можно сделать вывод, что по гену эстрогенового рецептора генное равновесие не нарушено.

Степень гомозиготности (Са) в исследованной популяции свиней породы дюрок составила 66,8%, СМ-1СТ – 56,4%, что свидетельствует о более высокой степени консолидации в стаде породы дюрок (табл. 3). Число эффективно действующих аллелей в гене ESR свиней породы дюрок составило – 1,50, СМ-1 СТ – 1,77, при максимальном значении уровня полиморфности возможном при двухаллельном локусе.

Таблица 3 - Генетическая структура пород свиней по гену эстрогенного рецептора

Показатели Порода
Дюрок, n=75 Скороспелая мясная СТ, n=75
Фактически Теоретически Фактически Теоретически
Гетерозиготы 23 24,88 35 32,64
Гомозиготы 52 50,1 40 42,3
Коэффициент гетеро/гомозиготы 0,442 0,496 0,875 0,772
Тест гетерозиготности, ТГ -0,054 - 0,103 -
Степень гомозиготности, Са, % 66,82 - 56,4 -
Уровень полиморфности, Nа 1,50 - 1,77 -
Доля гомозигот, % 69,3 - 53,3 -


Pages:   || 2 | 3 | 4 |
 

Похожие работы:










 
© 2013 www.dislib.ru - «Авторефераты диссертаций - бесплатно»

Материалы этого сайта размещены для ознакомления, все права принадлежат их авторам.
Если Вы не согласны с тем, что Ваш материал размещён на этом сайте, пожалуйста, напишите нам, мы в течении 1-2 рабочих дней удалим его.